From 02481656966b0a8dfc95cf3c22bcc049660ff7d4 Mon Sep 17 00:00:00 2001
From: Federico Igne <git@federicoigne.com>
Date: Sat, 26 Dec 2020 17:48:38 +0000
Subject: Move Rust exercises in a subdirectory

---
 nucleotide-count/tests/nucleotide-count.rs | 88 ------------------------------
 1 file changed, 88 deletions(-)
 delete mode 100644 nucleotide-count/tests/nucleotide-count.rs

(limited to 'nucleotide-count/tests/nucleotide-count.rs')

diff --git a/nucleotide-count/tests/nucleotide-count.rs b/nucleotide-count/tests/nucleotide-count.rs
deleted file mode 100644
index 8190580..0000000
--- a/nucleotide-count/tests/nucleotide-count.rs
+++ /dev/null
@@ -1,88 +0,0 @@
-use nucleotide_count as dna;
-
-use std::collections::HashMap;
-
-fn process_nucleotidecounts_case(s: &str, pairs: &[(char, usize)]) {
-    // The reason for the awkward code in here is to ensure that the failure
-    // message for assert_eq! is as informative as possible. A simpler
-    // solution would simply check the length of the map, and then
-    // check for the presence and value of each key in the given pairs vector.
-    let mut m: HashMap<char, usize> = dna::nucleotide_counts(s).unwrap();
-    for &(k, v) in pairs.iter() {
-        assert_eq!((k, m.remove(&k)), (k, Some(v)));
-    }
-
-    // may fail with a message that clearly shows all extra pairs in the map
-    assert_eq!(m.iter().collect::<Vec<(&char, &usize)>>(), vec![]);
-}
-
-#[test]
-fn count_returns_result() {
-    assert!(dna::count('A', "").is_ok());
-}
-
-#[test]
-fn test_count_empty() {
-    assert_eq!(dna::count('A', ""), Ok(0));
-}
-
-#[test]
-fn count_invalid_nucleotide() {
-    assert_eq!(dna::count('X', "A"), Err('X'));
-}
-
-#[test]
-fn count_invalid_dna() {
-    assert_eq!(dna::count('A', "AX"), Err('X'));
-}
-
-#[test]
-fn test_count_repetitive_cytosine() {
-    assert_eq!(dna::count('C', "CCCCC"), Ok(5));
-}
-
-#[test]
-fn test_count_only_thymine() {
-    assert_eq!(dna::count('T', "GGGGGTAACCCGG"), Ok(1));
-}
-
-#[test]
-fn counts_returns_result() {
-    assert!(dna::nucleotide_counts("ACGT").is_ok());
-}
-
-#[test]
-fn test_empty_strand() {
-    process_nucleotidecounts_case("", &[('A', 0), ('T', 0), ('C', 0), ('G', 0)]);
-}
-
-#[test]
-/// can count one nucleotide in single-character input
-fn test_can_count_one_nucleotide_in_singlecharacter_input() {
-    process_nucleotidecounts_case("G", &[('A', 0), ('C', 0), ('G', 1), ('T', 0)]);
-}
-
-#[test]
-fn test_strand_with_repeated_nucleotide() {
-    process_nucleotidecounts_case("GGGGGGG", &[('A', 0), ('T', 0), ('C', 0), ('G', 7)]);
-}
-
-#[test]
-/// strand with multiple nucleotides
-fn test_strand_with_multiple_nucleotides() {
-    process_nucleotidecounts_case(
-        "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
-        &[('A', 20), ('T', 21), ('C', 12), ('G', 17)],
-    );
-}
-
-#[test]
-fn counts_invalid_nucleotide_results_in_err() {
-    assert_eq!(dna::nucleotide_counts("GGXXX"), Err('X'));
-}
-
-#[test]
-/// strand with invalid nucleotides
-fn test_strand_with_invalid_nucleotides() {
-    assert_eq!(dna::nucleotide_counts("AGXXACT"), Err('X'),);
-}
-- 
cgit v1.2.3